RegulonDB RegulonDB 11.1: Gene Sequence
cyuP gene sequence


Size: 1332        A: 273  T: 385  G: 376  C: 298

Fasta

 

>cyuP E. coli K12. Version NC_000913.3 GI:556503834
atggaaattgcatcgaataaaggcgtcattgcagacgcttcgaccccggcgggtcgtgct
ggaatgagtgagagcgagtggcgagaagcgatcaaattcgacagtactgacaccggctgg
gtgattatgagtatcgggatggcgattggcgcggggattgtttttctcccggtgcaggtc
ggtttgatgggattgtgggtatttttgctctcatcggtgattggttacccggcaatgtat
ctgtttcagcgattgtttattaatacgctggcagaatcaccagaatgtaaagattacccg
agcgtcattagcggttatttaggtaaaaactggggcatcctgttaggtgcgctctatttc
gtaatgctggtgatttggatgttcgtctattccaccgccatcaccaacgatagtgcttcc
tacctgcataccttcggcgtgacggaagggttgctgtcagacagtcccttttatggtctg
gtactgatttgcattctggtggcgatctcctcacgcggcgagaaattgttattcaaaatt
tcgaccggcatggtgctgaccaagctgctggtggtcgcggcgctgggcgtgtcgatggtg
ggaatgtggcatctgtataacgtcggttcgctaccgccgctggggctgctggtgaaaaac
gccattattacgctgccgtttaccctgacgtcgattctgtttatccagacgttaagtccg
atggtgatctcttatcgctcgcgggaaaaatcaattgaagtggcgcggcataaagcattg
cgggcaatgaatatcgcgtttggcattttgtttgtcaccgtctttttctacgccgtgtcg
ttcacgctggcgatgggacatgacgaagcggtaaaagcctatgagcagaatatttccgcg
ctggcgattgccgcacagtttattagcggtgacggcgcagcgtgggtgaaagtggtcagc
gtcattctcaatatctttgctgtcatgactgcattctttggcgtctatttaggctttcgc
gaagcaacgcaagggatcgtaatgaacatcctgcgtcgcaagatgcctgccgagaagatt
aacgaaaatctcgttcagcgcggcatcatgattttcgccattttgctggcctggagcgcc
atcgtactgaacgcaccggtgttgagcttcacctctatctgtagcccgattttcggcatg
gtagggtgcctgatcccggcgtggctggtttacaaagtaccagcattgcacaaatacaaa
gggatgtctctgtacctgattatcgtcactggtttgttgctgtgtgtttctccgttcctg
gcattttcttga
              
                            

Download fasta file
RegulonDB