RegulonDB RegulonDB 10.10: Gene Sequence
yrbG gene sequence


Size: 978        A: 183  T: 286  G: 270  C: 239

Fasta

 

>yrbG E. coli K12. Version NC_000913.3 GI:556503834
atgcttttagctacggcactgttaattgttggtttacttttggtcgtttacagtgccgac
cgcctggtttttgccgcgtctattctttgccgaacctttggcatcccgccgctgatcatc
ggcatgacggtggtcagtattggtacatcgttaccagaagtcatcgtctcgcttgccgcg
tctctgcacgaacaacgcgatttagccgttggtacagccctcggctcaaacattatcaat
atattgctgatcctcggtctggctgcgctggttcgtccttttaccgtccattctgatgtt
ctacgccgtgaattacccttaatgttgttggtcagcgtggtggccggttccgtactctat
gacggacaacttagtcgcagcgatggtatctttctcctctttctggctgtgctatggctg
ctgttcattgttaaacttgcacgtcaggctgaacgtcaggggactgacagcctgaccaga
gagcagcttgcagagctgccgcgtgacggcggattgcccgtcgcgtttttatggctcggc
attgcgcttatcatcatgccagtggccacgcggatggtggttgataacgccacggtgctg
gcgaattactttgccatcagcgagttgacgatgggtctgacggcaattgctatcggaacc
agcctgccggaactggcaaccgcaatagcgggggttcgcaaaggtgaaaacgacattgct
gtcggaaatatcattggcgcaaacatttttaatattgtcatcgtgttgggtttacccgcg
ctgataacgccaggagagattgatccactggcgtacagtcgtgactacagcgtgatgttg
ctggtgagcattatttttgcgttgctgtgctggcggcgctccccgcaaccgggccgtggt
gtaggggtattattaactggcggatttatcgtatggctggcgatgttgtactggttatcg
ccaatactcgttgaataa
              
                            

Download fasta file
RegulonDB