RegulonDB RegulonDB 10.9: Gene Sequence
ybaM gene sequence


Size: 162        A: 46  T: 38  G: 47  C: 31

Fasta

 

>ybaM E. coli K12. Version NC_000913.3 GI:556503834
atgtcactggaaaatgcccctgacgatgtcaaactggctgtcgatttgattgtgctgctg
gaggaaaatcagatccctgccagtaccgtgctgcgcgcgctggatattgtaaagcgtgat
tatgaaaagaaattaacgcgcgatgatgaggcggaaaagtga
              
                            

Download fasta file
RegulonDB