RegulonDB RegulonDB 10.10: Gene Sequence
yhdW gene sequence


Size: 1025        A: 269  T: 246  G: 275  C: 235

Fasta

 

>yhdW E. coli K12. Version NC_000913.3 GI:556503834
atgaaaaagatgatgatagccacactggctgccgccagcgtgctgcttgccgttgcaaat
caggcgctgctggcgcgacgcttgatgccgttcagaaaaaaggttttgtgcaatgcggga
tcagtgatggattacctgggttctcttatgccgatgctgacggtaagttttcaggtattg
atgttgatatttgtcgtggtgttgccgctgctgtatttggtgacgacacgaaagtgaaat
ataccccgctcactgcaaaagaacgcttcaccgctttacagtcaggggaggtggatttgc
tctcccgtaatacgacctggacttcatctcgcgatgccgggatgggaatggcatttaccg
gcgtcacttattacgacggcattggcttcctgacgcacgataaagcggggctaaaaagcg
cgaaagaactggatggcgctaccgtctgtattcaggcgggtactgataccgaactcaacg
tcgccgactacttcaaggcaaacaatatgaagtacacaccggtgactttcgatcgctctg
acgaatcagcgaaggcactggaatctggtcgctgcgatacgctggcctcggatcaatcac
aactgtatgccctgcgcatcaaattaagcaacccagctgaatggattgtcttaccggaag
ttatctcaaaagaaccgcttggtccggtagttcgtcgtggcgatgatgaatggttctcga
ttgtacgctggacgcttttcgccatgctgaatgctgaagagatgggcatcaattcccaga
acgtcgatgaaaaagcggctaatccagcaacgcctgatatggcacatctgctgggtaaag
aaggcgattacggcaaggatctgaagctggataataaatgggcctataacatcatcaaac
aggtgggtaactactcggaaatttttgagcgtaacgtaggttcagaaagcccgctgaaaa
ttaaacgtgggcaaaataatctctggaataacggcggtattcagtacgcaccgcccgtgc
gttaa
              
                            

Download fasta file
RegulonDB