RegulonDB RegulonDB 10.10: Gene Sequence
yhdY gene sequence


Size: 1104        A: 216  T: 309  G: 317  C: 262

Fasta

 

>yhdY E. coli K12. Version NC_000913.3 GI:556503834
atgacaaaagtattgctgtctcatcccccgcgcccggcgagccataactcaagccgcgcg
atggtgtgggtgcgaaaaaatctgttctccagctggagcaatagcctgctgactattggc
tgcatatggttgatgtgggaactgatcccaccgttgctgaactgggcatttttgcaggct
aactgggttggctcaacgcgtgccgactgcacaaaagccggtgcctgttgggtcttcatc
cacgaacgatttggtcagtttatgtatgggctttacccacacgaccaacgctggcgaatt
aacctcgcattactgattgggcttgtgtcgatcgcaccaatgttctggaaaatactcccg
catcgcggtcgctatattgcggcctgggcggtgatttacccactgattgtctggtggctg
atgtatggcggtttttttgctcttgagcgggttgaaacccggcaatggggcgggctgacg
ctaactttaattattgcatcagttgggattgcgggggcgctaccgtgggggatcttactg
gcgttaggtcgccgctcccatatgccgattgtgcgtatcttatcggtcatttttatcgaa
ttctggcgcggcgtgccgctgattaccgttctgtttatgtcttcggtcatgctgccgttg
tttatggcagaaggcaccagtatcgacaaattgatccgcgcgctggttggcgtgatcctg
tttcagtcagcatatgttgcggaagtcgtgcgaggtggattacaggcgctgcctaaaggg
caatatgaagcggcagagtcgctggcgttgggttactggaaaactcaggggctggttatt
ctgccacaggcgttgaagctggtaattcctgggctggtaaataccatcatcgcactcttc
aaagataccagcctggtgatcattatcgggttgttcgatcttttcagtagcgttcagcag
gcaaccgttgatcccgcctggttgggtatgtcgacggaagggtatgttttcgccgcgctg
atctactggatcttctgtttcagcatgtcgcgctatagccagtatctggaaaaacgtttt
aacaccgggcgtacaccgcattga
              
                            

Download fasta file
RegulonDB