RegulonDB RegulonDB 10.9: Gene Sequence
ybaN gene sequence


Size: 378        A: 64  T: 117  G: 103  C: 94

Fasta

 

>ybaN E. coli K12. Version NC_000913.3 GI:556503834
atgcaacgaatcattttaatcatcattggctggctggcggtagtgctgggtacgctgggc
gtggtattaccggtattaccgacgacgccgtttatcctgctggcggcctggtgctttgcc
cgttcttccccgcgctttcacgcctggttgctgtaccgctcatggtttggcagctatcta
cgtttctggcagaaacatcatgcgatgccgcgcggcgtcaaaccgcgggcgattttgctt
attttgctcacgtttgccatttctctgtggttcgtccagatgccatgggtgcgcatcatg
ttgctggtaattctcgcctgtttgcttttctatatgtggcgaattccggtgattgatgaa
aagcaagaaaagcactga
              
                            

Download fasta file
RegulonDB