RegulonDB RegulonDB 10.9: Gene Sequence
yfaL gene sequence


Size: 3753        A: 937  T: 888  G: 1079  C: 849

Fasta

 

>yfaL E. coli K12. Version NC_000913.3 GI:556503834
atgcggattatctttctacgcaaggagtatttatctttactcccgtcaatgattgcatct
cttttctctgctaacggtgtcgcggcggtcactgattcatgccagggatatgatgtcaaa
gcgagttgtcaggccagcaggcaaagcctttcaggcattacgcaggactggagtatcgct
gatgggcaatggctggttttttcggatatgaccaataacgccagcggtggggccgtattt
ttgcaacaaggagcggaattttcactattaccagaaaatgaaactggaatgactctgttt
gccaataacaccgttacaggagaatataataacggcggggccatatttgctaaagaaaac
tcaacgctgaatcttactgatgttattttttccggtaacgtcgcaggcggctatggtggc
gcaatctattcttctggtactaacgatactggtgccgtcgatttacgtgtcactaacgcc
atgtttcgcaataacatcgctaatgatggcaaaggtggcgcaatttataccattaataat
gacgtttatttaagtgatgttatttttgataacaaccaggcatatacatcaacaagttac
agtgatggcgatggcggggcaatcgatgttaccgataataatagcgacagcaagcatcct
tcaggttatacgatagtaaataacactgcctttacaaataacactgccgaaggttatggc
ggggcgatatataccaatagcgtgacggctccctatcttattgatatttctgttgatgac
agctacagccagaacggaggcgtgttagtcgatgagaacaatagcgcagcaggctatgga
gatggtccttcctctgcggcgggtggctttatgtatctcggcttaagtgaagttaccttt
gatattgccgacggaaaaacgctggttattggcaatacagagaatgacggagctgttgac
tctattgctggtaccgggttaatcaccaaaacaggttccggcgatctggtacttaatgca
gataacaatgactttactggtgagatgcagattgaaaacggtgaagttaccctgggccgc
agcaactccctgatgaatgtcggcgatacgcattgccaggacgatccgcaagactgctac
ggtctgacgatagggagtattgatcagtatcagaatcaggctgagctaaacgttggctcg
acccaacaaacttttgtgcacgcattgacgggctttcagaatggcactttaaatatcgat
gctggtggcaacgttactgttaatcagggcagttttgctggcatcatcgaaggtgctggt
cagctcaccattgcgcaaaacggcagctacgtgctggcaggggcgcagtcgatggcgcta
accggcgatatagtcgttgatgatggtgcggtgctttcgctggaaggcgacgcggcagat
cttaccgctctccaggacgatccgcagtcgatcgtgttaaacggcggtgtgctcgatctc
tctgatttctccacctggcagagcggcacatcatacaacgatggccttgaagtcagtggc
agcagcggaacggttatcggcagtcaggatgtggtagatcttgcaggtggcgacaatttg
catatcggcggcgacgggaaagatggcgtctacgtggtggtcgatgcgagcgacgggcag
gtaagtctggcaaacaataatagttatttgggcacaacacaaatcgcctccggtacgctg
atggtgagcgacaactcgcagcttggagatacccactataaccgccaggttatctttacc
gataagcaacaagaaagcgtgatggagattacctccgacgttgacacgcgttcagatgcg
gcaggccacggacgtgatattgaaatgcgcgccgacggtgaagtggcagttgatgcgggg
gtagacacgcagtggggcgcactgatggctgacagcagcgggcagcatcaggatgagggt
agcacattgactaaaacgggggctggtacactggagctgaccgccagcggtacaacgcag
tcggcggtacgtgtcgaagaaggcaccctgaaaggtgatgttgctgatatccttccttat
gcttcgtcactgtgggttggtgatggggcaacgttcgttactggcgcggatcaggatatt
cagtcaattgatgctatttccagcggcactatcgacatcagcgatggtacggttttgcgc
ctgaccgggcaggatacttccgtcgcccttaatgcctcactatttaacggcgatgggacg
ctggtgaatgccaccgatggtgtgacgttgacaggtgagcttaataccaaccttgaaact
gacagcctgacttatctttccaacgtgacggttaatggcaatctgaccaatacgtccggt
gcggttagcctgcaaaatggcgtcgctggcgatacgctgacggtaaacggtgattatacc
ggcggcggtacgctactgctcgatagcgaattaaacggcgatgactcggtaagcgatcaa
ttggtgatgaacggtaatactgctggcaacacaactgtggtggttaactccattacaggg
attggtgagccgacatcgacaggcattaaagtggttgatttcgcagctgatcccacgcag
tttcaaaacaatgcgcagttcagtctggcaggcagcggctacgtcaatatgggagcgtat
gactacacgctggtggaagataacaacgactggtatctgcgatcgcaagaagtaacgccg
ccatcgccacctgatccagacccgactcccgatcctgatcccacgccggatcctgatcca
acacccgacccggaacctacgcctgcttaccagccggtgttgaatgccaaagttggcggt
tatcttaataacctgcgggcggcaaatcaggcgtttatgatggagcgacgcgatcacgca
ggtggcgatggtcagacgctgaatttacgtgttatcggcggagattatcattacacagca
gcggggcaactggctcaacatgaagacacttctacggtgcaacttagcggcgatctgttt
agcgggcgctggggcacggatggcgagtggatgcttgggattgttggtggctacagcgat
aaccagggcgacagccgctcgaatatgaccggaactcgcgccgataaccagaaccacggt
tatgccgttgggctgacatcaagctggtttcagcacggtaatcagaagcaaggggcctgg
ctggatagctggctgcaatacgcgtggtttagcaatgatgtttccgaacaagaagatggc
acagatcattaccactcgtcggggattatcgcctcgctggaggcggggtatcagtggtta
ccggggcgtggtgtggtgattgaaccgcaggcgcaggtgatttatcagggcgtgcagcag
gatgattttaccgccgctaaccgtgcgcgcgtgtcacaatcgcagggtgatgatattcag
acgcggctgggtttacacagcgaatggcgtaccgctgttcatgtcataccaacattagat
ctgaattattatcacgatccccattcgacggaaattgaagaggatggcagcactatcagt
gacgatgcggtgaagcaacggggtgaaataaaagtgggagtcacgggcaatatcagtcag
cgagtgtccctgcgcggcagcgtggcgtggcagaaagggagtgatgattttgcccagacg
gcagggtttttgtcgatgacggtgaaatggtaa
              
                            

Download fasta file
RegulonDB