RegulonDB RegulonDB 10.9: Gene Sequence
ybeL gene sequence


Size: 483        A: 132  T: 97  G: 144  C: 110

Fasta

 

>ybeL E. coli K12. Version NC_000913.3 GI:556503834
atgaacaaggttgctcaatattaccgtgaactggttgcgtcactgagcgaacgcctgcgc
aatggcgaacgtgatatcgacgcactggtggaacaggcgcgcgagcgcgtaataaaaaca
ggggagttaacgcgaaccgaggtcgatgagctgacgcgagctgtcagacgtgacctggaa
gagttcgccatgagctatgaagagagcctgaaagaagaatctgacagcgtctttatgcgg
gtgattaaagaaagcttgtggcaggagctggcagacatcaccgataaaacgcagcttgaa
tggcgcgaagttttccaggacctcaatcatcatggggtttatcacagcggagaagtggtc
gggctgggaaatctggtctgcgagaaatgtcacttccatctcccgatctacacaccggaa
gtgctgacgctatgcccgaaatgtggtcatgaccagttccagagacgcccgtttgagccg
taa
              
                            

Download fasta file
RegulonDB