RegulonDB RegulonDB 10.10: Gene Sequence
abgT gene sequence


Size: 1527        A: 302  T: 473  G: 385  C: 367

Fasta

 

>abgT E. coli K12. Version NC_000913.3 GI:556503834
atgagtatgtcatccataccgtcgtcctcccaatccgggaagctctatggctgggtcgaa
agaattggtaacaaggttccccatccttttctgctctttatctatttgattatcgtactc
atggtgacgacggcaattttgtcggcctttggcgtcagtgcgaaaaacccgaccgatggt
acgccggtcgtggtgaaaaacctgctcagtgtggaaggattacactggtttttacccaat
gttattaaaaactttagcggttttgctccacttggtgcgatcctggcgctggttttaggt
gccggtctggcggagcgcgtcggcttactgccagcactaatggttaaaatggcatcgcat
gttaatgcccgctacgccagttatatggtgctgtttattgcttttttcagccacatttct
tccgatgcggcgttagtgatcatgccaccgatgggtgcgctgatttttctggcggtgggc
aggcatccagttgcaggtttactggctgccattgcaggcgtaggttgcggctttacggct
aatttactgattgtcacaaccgacgtgttgctgtcggggatcagcacggaagcggcagct
gcgttcaatccgcaaatgcacgtcagtgtaattgataactggtattttatggccagctcc
gtagtcgtactgacgattgttggcggcctgataaccgacaaaatcatcgagccacggtta
ggtcaatggcagggaaacagcgatgagaaactgcagacattgaccgaaagtcagcgtttt
ggtttacgcatagcaggtgtcgtatcgctactttttattgctgcgattgcgctgatggtg
atcccgcaaaacgggatattgcgcgatccgattaatcacaccgtgatgccatcacccttt
attaaaggtatcgtgccactgatcattctttttttctttgttgtctcgctggcttatggc
atcgctacccgcacaattcgacgtcaggcggatttaccgcatttaatgattgaaccgatg
aaagagatggcgggatttatcgtgatggtttttcccctcgcccaatttgtcgccatgttt
aactggagcaacatggggaaattcatcgccgtggggctgaccgatatactggaaagttca
gggcttagcggcatcccggcgtttgtcggtctggcgttgctttcctctttcttatgcatg
tttattgccagcggttccgcaatctggtcgattctcgcccccattttcgtaccaatgttt
atgctacttggctttcacccggcatttgcgcaaatcctctttcgtattgccgactcatcc
gtattgcctttagcgccggtatctccttttgttccactgtttcttggattcctgcaacgc
tacaaaccagacgcgaaactgggtacttactattcgttagtcttgccctatccacttatc
tttttggtggtatggctgctgatgttgctggcgtggtatcttgtcggtctgccgataggt
ccgggtatttacccacgtttgtcttaa
              
                            

Download fasta file
RegulonDB