RegulonDB RegulonDB 10.9: Gene Sequence
cpoB gene sequence


Size: 792        A: 227  T: 173  G: 199  C: 193

Fasta

 

>cpoB E. coli K12. Version NC_000913.3 GI:556503834
atgagcagtaacttcagacatcaactattgagtctgtcgttactggttggtatagcggcc
ccctgggccgcttttgctcaggcaccaatcagtagtgtcggctcaggctcggtcgaagac
cgcgtcactcaacttgagcgtatttctaatgctcacagccagcttttaacccaactccag
caacaactttctgataatcaatccgatattgattccctgcgtggtcagattcaggaaaat
cagtatcaactgaatcaggtcgtggagcggcaaaagcagatcctgttgcagatcgacagc
ctcagcagcggtggtgcagcggcgcaatcaaccagcggcgatcaaagcggtgcggcggca
tcaacgacgccgacagctgatgctggtactgcgaatgctggcgcgccggtgaaaagcggt
aatgcaaacacggattacaatgcagctattgcgctggtgcaggataaatcccgccaggat
gacgcaatggtggcatttcagaatttcatcaaaaattaccctgattcaacttacctgcca
aacgccaattattggctgggtcagttaaactacaacaagggtaaaaaagatgatgcggcg
tactattttgcttcggtagtgaaaaactatccgaagtcaccaaaggctgcagatgcgatg
tttaaagtcggcgtcatcatgcaggacaaaggtgacaccgcaaaagcgaaagccgtatac
cagcaggttatcagtaaataccctggtactgatggcgctaaacaggcacaaaaacgtctg
aacgcgatgtaa
              
                            

Download fasta file
RegulonDB