RegulonDB RegulonDB 10.9: Gene Sequence
matP gene sequence


Size: 453        A: 143  T: 101  G: 119  C: 90

Fasta

 

>matP E. coli K12. Version NC_000913.3 GI:556503834
atgaaatatcaacaacttgaaaatcttgaaagcggttggaaatggaagtatctggttaag
aagcatcgcgaaggggagttaatcacccgttacatagaagccagtgccgcccaggaagcc
gtcgatgtgttgctctcgctggaaaatgaacccgtgctggtaaatggctggattgacaag
catatgaatccggaactggtcaatcgcatgaagcaaaccattcgggcaagacgaaagcgc
cattttaatgcggaacaccagcatacgcgcaaaaaatcgatcgatctggaatttattgtc
tggcaacgtctggctggtcttgcgcagcgtcgcggtaaaacgctttctgaaacgattgtt
cagctgattgaagatgcggaaaacaaagagaaatacgcgaataaaatgtcttctctgaag
caggatctgcaggcattgctgggtaaggaataa
              
                            

Download fasta file
RegulonDB