RegulonDB RegulonDB 10.9: Gene Sequence
opgD gene sequence


Size: 1656        A: 394  T: 421  G: 440  C: 401

Fasta

 

>opgD E. coli K12. Version NC_000913.3 GI:556503834
atggatcgtagacgatttattaaaggttcaatggctatggccgccgtgtgcggtaccagc
ggcattgcttctcttttttctcaggcggcattcgcggcagattctgatattgccgacggg
caaacccagcgttttgacttctccattctacagtcaatggcgcacgacttagcgcaaaca
gcgtggcgtggtgcgcctcgtccgttacctgacacgctggcgacaatgacgccgcaggct
tataacagtattcaatacgacgccgaaaaatcgctctggcataacgttgagaaccgtcaa
ctggacgctcagttcttccatatgggaatgggattccgtcgccgcgttcgtatgttttct
gtagatccagcaacacatctggcgcgtgaaattcactttcgcccggagttgttcaaatac
aacgatgcaggtgttgatacaaaacaattagaagggcaaagcgatctcggctttgccggt
tttcgcgtgtttaaagcccccgaactggcgcgccgtgatgtagtatcatttctcggcgcg
agttatttccgcgccgttgatgatacatatcaatacggtttgtcggcccgcggcctggcg
atcgacacttacaccgacagtaaagaagagttccccgactttaccgccttctggtttgat
acggtaaaaccgggggcaactacctttaccgtttatgcgttgctcgatagcgccagcatt
actggtgcctataagttcactatccattgtgagaaaagtcaggtgattatggatgtggaa
aatcacctgtatgcgcgcaaagacattaaacagctgggcattgcgccgatgaccagtatg
ttcagctgcggtactaatgaacgtcggatgtgcgatacaattcatccgcaaattcatgac
tctgatcgtctgtccatgtggcggggcaacggcgagtggatttgccgtccgctgaataat
ccgcaaaaattgcagttcaatgcttacaccgacaacaacccgaaagggtttggtttattg
caactggatcgtgacttctcccattatcaggacattatgggctggtataacaaacgccca
agtctgtgggtggaaccgcgtaacaagtggggtaagggcaccatcggcctgatggaaatc
ccaacaacgggcgaaacgctggataacattgtctgcttctggcagccagaaaaagctgta
aaagcaggtgatgagtttgcattccagtatcgtctgtactggagtgcgcaaccgcctgtt
cattgcccattagcgcgcgttatggcgacgcgtaccggcatgggcggtttctcggaaggt
tgggcgccaggtgaacactatcccgaaaaatgggcgcgtcgttttgccgtcgatttcgtt
ggtggtgatctgaaagctgccgcgccaaaaggcattgagccggtgattacgctttccagt
ggggaagcgaagcaaatcgaaattctctatattgaacccatcgatggttatcgtattcag
tttgactggtatccgacttcggactccactgatccggtcgatatgcggatgtatctacgt
tgtcagggggacgctatcagtgaaacatggctgtatcagtatttcccgccagcgccggat
aaacgtcagtatgttgacgaccgcgtgatgagttaa
              
                            

Download fasta file
RegulonDB