RegulonDB RegulonDB 10.9: Gene Sequence
yebK gene sequence


Size: 870        A: 225  T: 219  G: 220  C: 206

Fasta

 

>yebK E. coli K12. Version NC_000913.3 GI:556503834
atgaatatgctggaaaaaatccagtctcagctggaacatttgagcaaatcagagcgcaaa
gttgccgaggtcattctggcttcgcccgataacgcgatccattcgagtattgctgctatg
gcactggaagccaatgttagcgaaccgacggtgaatcgtttctgtcgcagcatggacacg
cgcggttttcctgattttaaacttcatctggcacagagtctggcgaatggcactccctat
gttaatcgcaatgtcaatgaagatgacagcgttgaatcatacacagggaaaatatttgag
tccgcaatggcaacgcttgatcatgtccgtcattcactggataaatctgccatcaaccgc
gccgtcgacttgctcactcaggcaaaaaaaatcgcctttttcggattaggctcttcagcc
gccgttgcccacgatgcgatgaataagttctttcgttttaatgttccggtggtgtactcc
gatgatatcgtgctgcaacgcatgagttgtatgaattgtagcgacggagacgtggtggtg
ctgatttctcacactggaagaacaaaaaatctggtcgagctggcgcagctggcacgcgaa
aacgacgccatggtgattgccctcacctctgcgggtaccccgctcgcccgggaagcaacg
ctggcaattaccctcgacgtaccggaagatactgacatttatatgcccatggtttctcga
cttgcacagctgaccgtgatagatgtgctggcgacaggatttactttgcgacgcggtgca
aaattcagagataacttgaagcgggtcaaagaagcgctgaaggaatcgcgttttgataag
cagttacttaatttaagtgacgatcgctaa
              
                            

Download fasta file
RegulonDB