RegulonDB RegulonDB 10.9: Gene Sequence
yecF gene sequence


Size: 225        A: 70  T: 47  G: 58  C: 50

Fasta

 

>yecF E. coli K12. Version NC_000913.3 GI:556503834
atgagtacgcctgatttttctactgccgagaataatcaagaactggcaaatgaagtctcc
tgcctgaaagcgatgctgacgctgatgctgcaggcgatgggacaagctgacgcgggccgc
gtgatgttaaagatggaaaaacagcttgcgctgatcgaagacgaaacccaggctgcagta
ttttccaaaacggttaagcaaattaaacaagcctaccgtcagtaa
              
                            

Download fasta file
RegulonDB