RegulonDB RegulonDB 10.9: Gene Sequence
ydcH gene sequence


Size: 225        A: 82  T: 50  G: 51  C: 42

Fasta

 

>ydcH E. coli K12. Version NC_000913.3 GI:556503834
atgtttccagaataccgagatttaatatcccgtctgaaaaacgaaaatcctcgctttatg
tccttgttcgataaacacaataaacttgatcatgaaattgccagaaaggaaggttccgac
ggtcgagggtacaatgcggaagtggtccgcatgaaaaaacaaaagctacagttaaaagat
gagatgctcaaaatcctgcagcaggagagcgtcaaagaggtgtaa
              
                            

Download fasta file
RegulonDB