RegulonDB RegulonDB 10.9: Gene Sequence
yciN gene sequence


Size: 252        A: 79  T: 54  G: 60  C: 59

Fasta

 

>yciN E. coli K12. Version NC_000913.3 GI:556503834
atgaacaaagagacacaacccatcgaccgcgaaacgctgttgaaagaggccaacaaaatc
attcgtgagcatgaggatacgctcgcagggattgaagccaccggcgtcacgcagcgtaat
ggcgtgctggtatttaccggcgactactttttagatgaacaaggattgccaacagccaaa
agcaccgcggtgtttaatatgttcaaacacctggcccatgtgctttcagaaaaatatcat
ctggttgattaa
              
                            

Download fasta file
RegulonDB