RegulonDB RegulonDB 10.9: Gene Sequence
ycjF gene sequence


Size: 1062        A: 237  T: 227  G: 338  C: 260

Fasta

 

>ycjF E. coli K12. Version NC_000913.3 GI:556503834
atgaccgaaccgttaaaaccacgtattgatttcgacggtcctctggaggtcgatcagaat
cctaaattcagggcgcagcagacctttgacgaaaatcaggcgcaaaattttgccccggcc
acgctcgacgaagcgcaggaagaagaggggcaagtcgaagcggtaatggacgcagcgtta
cgtccgaaacgcagcctgtggcgcaaaatggtgatgggagggctggctctgtttggcgca
agcgttgtcgggcagggtgtacagtggacaatgaatgcctggcaaacccaggactgggtg
gcgctgggtggatgtgccgctggggcattgattatcggcgctggcgtaggttctgtggta
acagagtggcggcgcttatggcgcttgcgacagcgcgcccatgaacgcgacgaagcgcgt
gatttattgcatagccacggcacgggcaaaggccgcgcattttgcgaaaaactggcgcag
caggcgggtattgatcagtcgcatccggcgctgcaacgctggtatgcctcaatccatgaa
acgcaaaacgaccgtgaagtggtcagcctgtatgcgcatttggtccagccagttttagat
gcccaggcgcggcgcgaaatcagccgttcggcggcggaatcaacgttgatgattgcggtc
agcccgctggcgttggtcgatatggcgtttatcgcctggcgcaatctgcgtttaattaat
cgcatcgccacgctgtatggcattgaactggggtattacagccgtttgcgtctgtttaag
ctggtattgctgaatatcgcttttgccggagccagcgaactggtgcgcgaagtggggatg
gactggatgtcgcaagatctcgctgctcgtttgtctacccgcgcagctcaggggattggt
gcaggacttctgacggcacgactcgggattaaagctatggagctttgccgcccgctgccg
tggattgacgatgacaaacctcgcctcggggatttccgtcgtcagcttatcggtcaggtg
aaagaaacgctgcaaaaaggcaaaacgcccagcgaaaaataa
              
                            

Download fasta file
RegulonDB