RegulonDB RegulonDB 10.9: Gene Sequence
ybhC gene sequence


Size: 1284        A: 304  T: 295  G: 349  C: 336

Fasta

 

>ybhC E. coli K12. Version NC_000913.3 GI:556503834
gtgaacacattttcagtttcccgtctggcgctggcattggcttttggcgtgacgctgacc
gcctgtagctcaaccccgcccgatcaacgtccttctgatcaaaccgcgcctggtacctct
tctcgcccgattctgtcggcaaaagaagcgcagaatttcgatgctcaacactattttgca
tccctgacaccaggtgctgcagcgtggaatccttccccgattaccctgcctgcgcaacct
gactttgttgtcggcccggcgggcactcaaggtgtaacgcataccacgattcaggcggcg
gtagatgcggcaattatcaagcgtaccaacaagcgccagtatattgccgtgatgcctggt
gagtatcagggaacggtatatgtccctgccgctccgggtggaattactctgtacggtaca
ggtgaaaaaccgattgatgtgaagattgggctttcccttgatggtggcatgagccctgcc
gactggcgtcacgacgtcaacccgcgcggcaaatatatgccaggtaaaccagcgtggtat
atgtacgatagctgccagagcaaacgcagcgacagtatcggtgttctctgctctgcggtc
ttctggtcacaaaacaatggcctgcaactgcaaaatctgaccatcgaaaacacgctgggc
gatagcgtagatgcaggtaaccatccggcggtggcactgcgtactgatggtgaccaggta
cagattaacaacgttaacattctcggtcgtcagaacaccttctttgtcaccaacagcggt
gtgcagaaccgtctggaaacgaatcgtcagccgcgtacgctggtgaccaacagctacatt
gaaggggatgtggatatcgtttctggtcgcggcgcagtggtgttcgataacaccgaattc
cgcgtggtgaactcacgtactcagcaagaagcgtatgtgtttgcaccggctacgctgtcc
aacatttactacggtttcctcgccgtaaacagccgtttcaatgctttcggtgatggtgtg
gcgcaactgggccgctcgctggatgttgatgccaataccaacggtcaggtggtgatccgt
gatagcgccatcaacgaaggttttaacacggctaaaccgtgggccgatgcggtgatctct
aatcgtccgtttgcgggtaataccggcagcgtagatgataacgacgaaatacagcgcaat
ctgaatgacactaactacaaccgcatgtgggaatacaataaccgcggcgtgggtagtaaa
gtggttgcagaggcgaagaagtaa
              
                            

Download fasta file
RegulonDB