RegulonDB RegulonDB 10.9: Gene Sequence
tusE gene sequence


Size: 330        A: 98  T: 78  G: 90  C: 64

Fasta

 

>tusE E. coli K12. Version NC_000913.3 GI:556503834
atgctgatcttcgaaggtaaagagatagaaacggataccgaaggctatctcaaagaaagc
agccagtggagtgagccgctggctgtggtgattgcagagaacgaagggatttcgctgtca
ccggaacactgggaagtggtgcgttttgtgcgtgatttctatctggaattcaatacttct
ccggcgattcgtatgctggtaaaagcgatggcgaataaatttggcgaagaaaaaggtaac
agccgctatttataccgactgtttccgaaaggtccggctaagcaagccaccaaaattgct
ggcctgccaaaaccggtaaaatgtatttaa
              
                            

Download fasta file
RegulonDB