RegulonDB RegulonDB 10.10: Gene Sequence
ycfK gene sequence


Size: 630        A: 160  T: 153  G: 178  C: 139

Fasta

 

>ycfK E. coli K12. Version NC_000913.3 GI:556503834
atgcatcgtatagacacgaaaaccgcgcagaaggataagttcggcgcgggtaagaacggt
tttacccgtggtaacccccagaccggcacgcctgccaccgatctggatgatgactacttt
gacatgttgcaggaggaactttgcagcgtggtggaggcatccggtgccagcctggagaag
gggcggcacgaccagttacttaccgcacttcgcgcgctgctgttaagccgcaagaatccg
tttggcgatatcaaatcggatggcactgtgcaaacggctctcgaaaaccttggtttggga
gaaggagcaaaactcaatgcagcaacggctacattaggacgcaccggtttcatagctata
ccggttatgattggtggtattgagcaatcagtaatcattcagtgggggtggaatgccgca
aaagcatctgcctctgggggggatggaaatacagttgtattcccggttgcgtttaataat
gcctgtgttgccgttgttgcaaattatgacaatgtcagcgcacctatcaatgcagtggca
acggggggatatacaaccacttcgtttttattacggtgcgcagctcaaacgggtagttat
tactataactggattgctattgggtattaa
              
                            

Download fasta file
RegulonDB