RegulonDB RegulonDB 10.9: Gene Sequence
dgcN gene sequence


Size: 1227        A: 331  T: 303  G: 281  C: 312

Fasta

 

>dgcN E. coli K12. Version NC_000913.3 GI:556503834
atgatggataacgataattctcttaataagcgccccacgtttaaaagagcattacgcaac
atcagtatgaccagcatatttatcactatgatgctgatctggttgctgctttccgtgacc
tcggtgctgaccctgaaacagtacgcgcaaaaaaacctggcactgacagcagcaacaatg
acttacagtctggaagcagctgtcgtttttgccgatggccctgcagcaactgaaacactg
gcagcgctgggccagcaagggcaattttcaactgcagaagtacgtgataagcagcaaaat
attctggcatcctggcattacacccgtaaggatccaggcgatactttcagtaatttcata
agccactggctcttccctgcccccatcattcagccgattcgtcacaatggtgaaaccatt
ggcgaagtacgcttaaccgctcgcgacagttcaatcagccattttatctggttttcgctc
gccgtactgaccggttgtattctgctggcatcaggcatcgcaattaccctcacccgccat
ttgcacaatggcctggtagaagcgctgaaaaatatcaccgatgtcgtacatgatgtgcgt
tccaaccgcaatttttcccgacgagtttcggaagaacgtatcgctgagtttcaccgcttc
gctctcgacttcaacagtctgctggatgaaatggaagagtggcagcttcgtttacaggct
aaaaatgcgcagcttctacgtaccgcgctacatgacccattaaccgggctggctaaccgc
gcagcgtttcgtagcggcatcaacacgttgatgaacaattccgatgcccgaaaaacgtcg
gcgttactatttcttgatggcgataatttcaaatacatcaatgatacctggggtcatgcg
acgggcgatagagtcttgattgaaatcgcaaaacggttagctgaatttggcgggctgcga
cataaagcataccgcctgggcggcgatgaattcgctatggtgctctatgatgtacagtcg
gaatctgaagtgcagcagatatgttcagcactgacacaaatctttaatctcccgtttgat
cttcataatggccatcagaccaccatgacattaagcattggttacgcgatgaccattgag
cacgcctctgcggaaaaattacaagagcttgccgatcacaatatgtatcaggccaaacac
cagcgtgccgaaaagctggtgagataa
              
                            

Download fasta file
RegulonDB