RegulonDB RegulonDB 10.10: Gene Sequence
glk gene sequence


Size: 966        A: 212  T: 256  G: 271  C: 227

Fasta

 

>glk E. coli K12. Version NC_000913.3 GI:556503834
atgacaaagtatgcattagtcggtgatgtgggcggcaccaacgcacgtcttgctctgtgt
gatattgccagtggtgaaatctcgcaggctaagacctattcagggcttgattaccccagc
ctcgaagcggtcattcgcgtttatcttgaagaacataaggtcgaggtgaaagacggctgt
attgccatcgcttgcccaattaccggtgactgggtggcgatgaccaaccatacctgggcg
ttctcaattgccgaaatgaaaaagaatctcggttttagccatctggaaattattaacgat
tttaccgctgtatcgatggcgatcccgatgctgaaaaaagagcatctgattcagtttggt
ggcgcagaaccggtcgaaggtaagcctattgcggtttacggtgccggaacggggcttggg
gttgcgcatctggtccatgtcgataagcgttgggtaagcttgccaggcgaaggcggtcac
gttgattttgcgccgaatagtgaagaagaggccattatcctcgaaatattgcgtgcggaa
attggtcatgtttcggcggagcgcgtgctttctggccctgggctggtgaatttgtatcgc
gcaattgtgaaagctgacaaccgcctgccagaaaatctcaagccaaaagatattaccgaa
cgcgcgctggctgacagctgcaccgattgccgccgcgcattgtcgctgttttgcgtcatt
atgggccgttttggcggcaatctggcgctcaatctcgggacatttggcggcgtgtttatt
gcgggcggtatcgtgccgcgcttccttgagttcttcaaagcctccggtttccgtgccgca
tttgaagataaagggcgctttaaagaatatgtccatgatattccggtgtatctcatcgtc
catgacaatccgggccttctcggttccggtgcacatttacgccagaccttaggtcacatt
ctgtaa
              
                            

Download fasta file
RegulonDB