RegulonDB RegulonDB 10.8: Gene Sequence
xapB gene sequence


Size: 1257        A: 251  T: 402  G: 331  C: 273

Fasta

 

>xapB E. coli K12. Version NC_000913.3 GI:556503834
atgagcatcgcgatgcgcttaaaggtaatgtcctttttgcaatattttatctgggggagc
tggctggttaccctcggctcttacatgattaatactcttcatttcaccggcgctaatgtt
ggcatggtttacagttccaaagggatcgccgcgattattatgcctggtataatggggatc
atcgcagacaaatggctgcgcgcagaacgtgcatacatgctgtgtcacctggtgtgtgcg
ggcgtacttttttatgcggcatccgtaactgatccggatatgatgttttgggtgatgtta
gtcaatgcgatggcgtttatgccgactattgcgttatcgaacagcgtctcttattcctgt
cttgcccaggcagggcttgacccggtgaccgctttcccgcccattcgcgtttttggtacg
gtggggttcattgtcgcgatgtgggcagtaagcctgctgcatctggaattgagtagtctg
cagctgtatatcgcgtccggtgcgtcattgctgctgtcggcttatgcgctgactttgccg
aagattccggttgcggagaaaaaagcgaccacatcgcttgccagcaagctgggtctggat
gccttcgtgctgtttaaaaatccacgcatggccatctttttcctctttgccatgatgctg
ggtgcggtactgcaaattaccaacgtttttggtaatccgttcctacatgatttcgcccgt
aacccggagtttgctgacagttttgtggtgaaatatccctccattttactgtcagtttca
cagatggcagaagtgggctttatactgactatcccattctttttaaagcgatttggcatt
aaaaccgtcatgctgatgagtatggtggcctggacgctgcgctttggcttcttcgcctat
ggcgatccgtcaacaaccggatttattttgctgctgctgtcgatgattgtttatggctgt
gcattcgatttcttcaatatttctggttcggtatttgtcgaacaggaagttgattccagc
attcgtgccagcgcgcaggggctctttatgaccatggtaaatggtgtcggcgcatgggtt
ggctcgattctgagtggcatggcagtagattacttttcggtggatggcgtaaaagactgg
caaactatctggctggtgtttgcaggatatgctctttttctcgcagtgatatttttcttt
gggtttaaatataatcatgaccctgaaaagataaagcatcgagcggtgactcattaa
              
                            

Download fasta file
RegulonDB