RegulonDB RegulonDB 10.9: Gene Sequence
dsdC gene sequence


Size: 936        A: 246  T: 240  G: 234  C: 216

Fasta

 

>dsdC E. coli K12. Version NC_000913.3 GI:556503834
atggaaccccttcgtgaaataagaaatcggctgcttaacggctggcaattatcaaaaatg
catacttttgaagtggctgccaggcatcagtccttcgccctggcggcagaggaattgtcg
ctgagccccagtgcggtaagtcaccgtatcaatcagctggaagaagaattgggcattcag
ttgtttgttcgttcccatcgcaaagtggaattaacgcacgaggggaaacgtgtttattgg
gcgctaaaatcgtcgctggataccctgaaccaggaaattcttgatatcaaaaatcaggag
ttatcgggaacgttaactctgtattcccggccctctatcgcccaatgctggttggtgccc
gcattaggtgactttacacgccggtatccgtctatttcgctcaccgtgctcactggtaat
gacaacgtcaatctgcaacgtgccggaatcgatttggcgatctactttgatgatgcgccg
tcagcgcaactcactcatcactttctgatggatgaagaaatcctgccagtatgtagcccg
gaatacgctcaaagacatgctttaaccaacacggtaattaacctgtgtcactgtacgttg
ctccatgacagacaggcatggagcaacgactccggtacggatgaatggcatagttgggcg
caacattatgcggttaatttgccgacatcttctggaattggctttgatcgttctgattta
gctgttattgccgcgatgaatcatattggggtggcgatgggaagaaaacgcctggtacaa
aaaaggcttgccagtggtgagctcgtcgcgccgtttggcgatatgacggtgaaatgccat
cagcattattacatcaccacattaccgggcaggcagtggccaaaaattgaagcgtttatt
atctggctaagagaacaggtaaaaaccacttcataa
              
                            

Download fasta file
RegulonDB