RegulonDB RegulonDB 10.9: Gene Sequence
cobU gene sequence


Size: 546        A: 134  T: 136  G: 170  C: 106

Fasta

 

>cobU E. coli K12. Version NC_000913.3 GI:556503834
atgatgattttggtgacggggggcgcacggagcgggaagagtcgccacgcagaggcgctt
attggggactcttcacaggttctgtatatcgctacctcgcaaatccttgatgatgagatg
gctgcacggatagaacatcatcggcaaggccgcccggagcactggcgcacagtggagcgc
tggcaacatcttgatgaattaattcatgcagacattaacccgaatgaggttgtgttgctt
gaatgcgttaccacaatggtgactaatctgttgtttgattatggcggcgataaagaccct
gatgaatgggattatcaggcgatggaacaggcgattaatgctgagattcagtcgttgatt
gctgcctgccaacgttgccccgcaaaggttgtattagtgactaacgaagtgggaatgggg
attgtgccggagagtcgtctggcacgacattttcgtgatattgccgggcgggtaaatcag
cagttggccgctgcggcaaatgaagtatggctggtggtttcgggtattggagtaaaaatc
aaatga
              
                            

Download fasta file
RegulonDB