RegulonDB RegulonDB 10.9: Gene Sequence
dctA gene sequence


Size: 1287        A: 272  T: 350  G: 352  C: 313

Fasta

 

>dctA E. coli K12. Version NC_000913.3 GI:556503834
atgaaaacctctctgtttaaaagcctttactttcaggtcctgacagcgatagccattggt
attctccttggccatttctatcctgaaataggcgagcaaatgaaaccgcttggcgacggc
ttcgttaagctcattaagatgatcatcgctcctgtcatcttttgtaccgtcgtaacgggc
attgcgggcatggaaagcatgaaggcggtcggtcgtaccggcgcagtcgcactgctttac
tttgaaattgtcagtaccatcgcgctgattattggtcttatcatcgttaacgtcgtgcag
cctggtgccggaatgaacgtcgatccggcaacgcttgatgcgaaagcggtagcggtttac
gccgatcaggcgaaagaccagggcattgtcgccttcattatggatgtcatcccggcgagc
gtcattggcgcatttgccagcggtaacattctgcaggtgctgctgtttgccgtactgttt
ggttttgcgctccaccgtctgggcagcaaaggccaactgatttttaacgtcatcgaaagt
ttctcgcaggtcatcttcggcatcatcaatatgatcatgcgtctggcacctattggtgcg
ttcggggcaatggcgtttaccatcggtaaatacggcgtcggcacactggtgcaactgggg
cagctgattatctgtttctacattacctgtatcctgtttgtggtgctggtattgggttca
atcgctaaagcgactggtttcagtatcttcaaatttatccgctacatccgtgaagaactg
ctgattgtactggggacttcatcttccgagtcggcgctgccgcgtatgctcgacaagatg
gagaaactcggctgccgtaaatcggtggtggggctggtcatcccgacaggctactcgttt
aaccttgatggcacatcgatatacctgacaatggcggcggtgtttatcgcccaggccact
aacagtcagatggatatcgtccaccaaatcacgctgttaatcgtgttgctgctttcttct
aaaggggcggcaggggtaacgggtagtggctttatcgtgctggcggcgacgctctctgcg
gtgggccatttgccggtagcgggtctggcgctgatcctcggtatcgaccgctttatgtca
gaagctcgtgcgctgactaacctggtcggtaacggcgtagcgaccattgtcgttgctaag
tgggtgaaagaactggaccacaaaaaactggacgatgtgctgaataatcgtgcgccggat
ggcaaaacgcacgaattatcctcttaa
              
                            

Download fasta file
RegulonDB