RegulonDB RegulonDB 10.9: Gene Sequence
pta gene sequence


Size: 2145        A: 482  T: 472  G: 576  C: 615

Fasta

 

>pta E. coli K12. Version NC_000913.3 GI:556503834
gtgtcccgtattattatgctgatccctaccggaaccagcgtcggtctgaccagcgtcagc
cttggcgtgatccgtgcaatggaacgcaaaggcgttcgtctgagcgttttcaaacctatc
gctcagccgcgtaccggtggcgatgcgcccgatcagactacgactatcgtgcgtgcgaac
tcttccaccacgacggccgctgaaccgctgaaaatgagctacgttgaaggtctgctttcc
agcaatcagaaagatgtgctgatggaagagatcgtcgcaaactaccacgctaacaccaaa
gacgctgaagtcgttctggttgaaggtctggtcccgacacgtaagcaccagtttgcccag
tctctgaactacgaaatcgctaaaacgctgaatgcggaaatcgtcttcgttatgtctcag
ggcactgacaccccggaacagctgaaagagcgtatcgaactgacccgcaacagcttcggc
ggtgccaaaaacaccaacatcaccggcgttatcgttaacaaactgaacgcaccggttgat
gaacagggtcgtactcgcccggatctgtccgagattttcgacgactcttccaaagctaaa
gtaaacaatgttgatccggcgaagctgcaagaatccagcccgctgccggttctcggcgct
gtgccgtggagctttgacctgatcgcgactcgtgcgatcgatatggctcgccacctgaat
gcgaccatcatcaacgaaggcgacatcaatactcgccgcgttaaatccgtcactttctgc
gcacgcagcattccgcacatgctggagcacttccgtgccggttctctgctggtgacttcc
gcagaccgtcctgacgtgctggtggccgcttgcctggcagccatgaacggcgtagaaatc
ggtgccctgctgctgactggcggttacgaaatggacgcgcgcatttctaaactgtgcgaa
cgtgctttcgctaccggcctgccggtatttatggtgaacaccaacacctggcagacctct
ctgagcctgcagagcttcaacctggaagttccggttgacgatcacgaacgtatcgagaaa
gttcaggaatacgttgctaactacatcaacgctgactggatcgaatctctgactgccact
tctgagcgcagccgtcgtctgtctccgcctgcgttccgttatcagctgactgaacttgcg
cgcaaagcgggcaaacgtatcgtactgccggaaggtgacgaaccgcgtaccgttaaagca
gccgctatctgtgctgaacgtggtatcgcaacttgcgtactgctgggtaatccggcagag
atcaaccgtgttgcagcgtctcagggtgtagaactgggtgcagggattgaaatcgttgat
ccagaagtggttcgcgaaagctatgttggtcgtctggtcgaactgcgtaagaacaaaggc
atgaccgaaaccgttgcccgcgaacagctggaagacaacgtggtgctcggtacgctgatg
ctggaacaggatgaagttgatggtctggtttccggtgctgttcacactaccgcaaacacc
atccgtccgccgctgcagctgatcaaaactgcaccgggcagctccctggtatcttccgtg
ttcttcatgctgctgccggaacaggtttacgtttacggtgactgtgcgatcaacccggat
ccgaccgctgaacagctggcagaaatcgcgattcagtccgctgattccgctgcggccttc
ggtatcgaaccgcgcgttgctatgctctcctactccaccggtacttctggtgcaggtagc
gacgtagaaaaagttcgcgaagcaactcgtctggcgcaggaaaaacgtcctgacctgatg
atcgacggtccgctgcagtacgacgctgcggtaatggctgacgttgcgaaatccaaagcg
ccgaactctccggttgcaggtcgcgctaccgtgttcatcttcccggatctgaacaccggt
aacaccacctacaaagcggtacagcgttctgccgacctgatctccatcgggccgatgctg
cagggtatgcgcaagccggttaacgacctgtcccgtggcgcactggttgacgatatcgtc
tacaccatcgcgctgactgcgattcagtctgcacagcagcagtaa
              
                            

Download fasta file
RegulonDB