RegulonDB RegulonDB 10.9: Gene Sequence
uxuB gene sequence


Size: 1461        A: 319  T: 300  G: 450  C: 392

Fasta

 

>uxuB E. coli K12. Version NC_000913.3 GI:556503834
atgactactattgttgacagcaatctgccggttgcccgcccgtcatgggatcattctcgt
ctggaatcacgcattgtgcatctcggttgcggggcgtttcaccgcgcgcaccaggcgctg
tatacccatcatctgctggaaagcaccgacagcgactggggcatctgcgaagttaacctg
atgccaggcaacgaccgcgtgctgatcgaaaacctgaaaaaacagcaactgctgtacacc
gtagcggaaaaaggcgcagagagcaccgagctgaaaattatcggttcgatgaaagaagcg
ctgcatccggaaatcgatggctgcgaaggtattctcaacgcgatggcgcgtccgcaaacg
gcgattgtctctctaacggtcacggaaaaaggctactgcgctgatgcggcaagcggtcaa
ctggatctcaataacccgctgatcaagcacgatctggaaaacccgactgcgccgaagtcc
gcgattggttacatcgtcgaagcgttgcgtctgcgtcgtgaaaaagggttgaaagcgttt
acggtgatgtcctgcgataacgtgcgtgaaaacggtcatgtggcgaaggtcgcggtactg
gggctggctcaggcgcgtgacccgcagctggcggcatggattgaagaaaatgtcaccttc
ccgtgcaccatggttgaccgcatcgttccggcggcgacgccagaaaccttacaggaaatt
gctgaccagctgggtgtttacgacccgtgcgccattgcctgcgaaccgttccgtcagtgg
gtgattgaagataacttcgttaatggtcgcccggattgggataaagtgggcgcacagttc
gttgcagacgttgtgccgttcgaaatgatgaagctgcgtatgctgaacggcagccactct
tttctggcgtacctcggttacctcggcggctatgaaaccattgccgacaccgtgactaac
ccggcttatcgcaaagcggcctttgccctgatgatgcaggaacaagcgccaacgctgtcg
atgccggaaggtacagacctgaacgcctatgcgacgctgctgatcgagcgtttcagcaac
ccgtctctgcgtcaccgtacctggcagattgcgatggacggcagccagaagttaccgcag
cgtctgctggacccggtgcgtctgcacctgcaaaacggcggcagctggcgtcacctggcg
ctgggcgtggctggctggatgcgttacacccagggcgtggatgagcagggtaatgccatt
gacgtggtcgacccgatgctggcggagttccagaagatcaacgcgcagtatcagggcgca
gaccgcgtgaaagcgctgctgggcctgagcggtatttttgccgatgatctgccgcagaat
gccgactttgttggcgcagtgacggcggcatatcagcagctgtgcgaacgcggtgcgcgc
gagtgtgtggctgcgctgtaa
              
                            

Download fasta file
RegulonDB