RegulonDB RegulonDB 10.9: Gene Sequence
uxuR gene sequence


Size: 774        A: 194  T: 165  G: 226  C: 189

Fasta

 

>uxuR E. coli K12. Version NC_000913.3 GI:556503834
atgaaatctgccacctctgcgcaaagaccttaccaggaagtcggggcgatgatccgcgat
ctgatcataaagacgccgtacaatcctggcgaacggctgccgccggagcgtgaaattgca
gaaatgcttgatgtcacgcggacggtggtacgtgaagcgctgatcatgctggagatcaaa
gggctggtggaagtacgccggggtgccggtatctatgttcttgataactcaggcagccag
aacacagacagtccggatgccaacgtctgcaacgatgccggtccttttgagctgttacag
gcgcggcagttattggagagcaacatcgccgagtttgccgctttgcaggctacccgcgaa
gatatcgtcaaaatgcgtcaggcattgcaactggaagagcgtgaactggcttccagtgcg
ccgggcagcagcgaaagcggtgacatgcagttccatctcgctattgccgaagcaacgcat
aacagcatgctggtggagctgttccgtcagtcctggcagtggcgggaaaacaatccaatg
tggatccagttgcacagccatctggatgacagcctgtatcgcaaagagtggttgggcgat
cacaaacagatcctcgccgcgttaatcaaaaaagatgcccgagcggcgaagctggcaatg
tggcagcatctggaaaacgttaagcaacgtctgctggaattctcgaacgttgacgatatt
tattttgatggctatctgtttgattcatggccgctggataaagtcgacgcctga
              
                            

Download fasta file
RegulonDB