RegulonDB RegulonDB 10.9: Gene Sequence
alaV gene sequence


Size: 76        A: 13  T: 15  G: 25  C: 23

Fasta

 

>alaV E. coli K12. Version NC_000913.3 GI:556503834
ggggctatagctcagctgggagagcgcctgctttgcacgcaggaggtctgcggttcgatc
ccgcatagctccacca
              
                            

Download fasta file
RegulonDB