RegulonDB RegulonDB 10.8: Gene Sequence
alaX gene sequence


Size: 76        A: 15  T: 15  G: 25  C: 21

Fasta

 

>alaX E. coli K12. Version NC_000913.3 GI:556503834
ggggctatagctcagctgggagagcgcttgcatggcatgcaagaggtcagcggttcgatc
ccgcttagctccacca
              
                            

Download fasta file
RegulonDB