RegulonDB RegulonDB 10.8: Gene Sequence
argW gene sequence


Size: 75        A: 19  T: 19  G: 18  C: 19

Fasta

 

>argW E. coli K12. Version NC_000913.3 GI:556503834
gtcctcttagttaaatggatataacgagcccctcctaagggctaattgcaggttcgattc
ctgcaggggacacca
              
                            

Download fasta file
RegulonDB