RegulonDB RegulonDB 10.8: Gene Sequence
argX gene sequence


Size: 77        A: 12  T: 13  G: 27  C: 25

Fasta

 

>argX E. coli K12. Version NC_000913.3 GI:556503834
gcgcccgtagctcagctggatagagcgctgccctccggaggcagaggtctcaggttcgaa
tcctgtcgggcgcgcca
              
                            

Download fasta file
RegulonDB