RegulonDB RegulonDB 10.9: Gene Sequence
asnV gene sequence


Size: 76        A: 16  T: 20  G: 22  C: 18

Fasta

 

>asnV E. coli K12. Version NC_000913.3 GI:556503834
tcctctgtagttcagtcggtagaacggcggactgttaatccgtatgtcactggttcgagt
ccagtcagaggagcca
              
                            

Download fasta file
RegulonDB