RegulonDB RegulonDB 10.9: Gene Sequence
aspU gene sequence


Size: 77        A: 11  T: 17  G: 27  C: 22

Fasta

 

>aspU E. coli K12. Version NC_000913.3 GI:556503834
ggagcggtagttcagtcggttagaatacctgcctgtcacgcagggggtcgcgggttcgag
tcccgtccgttccgcca
              
                            

Download fasta file
RegulonDB