RegulonDB RegulonDB 10.8: Gene Sequence
glnV gene sequence


Size: 75        A: 15  T: 16  G: 21  C: 23

Fasta

 

>glnV E. coli K12. Version NC_000913.3 GI:556503834
tggggtatcgccaagcggtaaggcaccggattctgattccggcattccgaggttcgaatc
ctcgtaccccagcca
              
                            

Download fasta file
RegulonDB