RegulonDB RegulonDB 10.9: Gene Sequence
glnW gene sequence


Size: 75        A: 15  T: 17  G: 21  C: 22

Fasta

 

>glnW E. coli K12. Version NC_000913.3 GI:556503834
tggggtatcgccaagcggtaaggcaccggtttttgataccggcattccctggttcgaatc
caggtaccccagcca
              
                            

Download fasta file
RegulonDB