RegulonDB RegulonDB 10.9: Gene Sequence
gltV gene sequence


Size: 76        A: 14  T: 13  G: 22  C: 27

Fasta

 

>gltV E. coli K12. Version NC_000913.3 GI:556503834
gtccccttcgtctagaggcccaggacaccgccctttcacggcggtaacaggggttcgaat
cccctaggggacgcca
              
                            

Download fasta file
RegulonDB