RegulonDB RegulonDB 10.8: Gene Sequence
glyT gene sequence


Size: 75        A: 13  T: 19  G: 19  C: 24

Fasta

 

>glyT E. coli K12. Version NC_000913.3 GI:556503834
gcgggcatcgtataatggctattacctcagccttccaagctgatgatgcgggttcgattc
ccgctgcccgctcca
              
                            

Download fasta file
RegulonDB