RegulonDB RegulonDB 10.9: Gene Sequence
ileV gene sequence


Size: 77        A: 16  T: 17  G: 25  C: 19

Fasta

 

>ileV E. coli K12. Version NC_000913.3 GI:556503834
aggcttgtagctcaggtggttagagcgcacccctgataagggtgaggtcggtggttcaag
tccactcaggcctacca
              
                            

Download fasta file
RegulonDB