RegulonDB RegulonDB 10.8: Gene Sequence
lysW gene sequence


Size: 76        A: 17  T: 21  G: 20  C: 18

Fasta

 

>lysW E. coli K12. Version NC_000913.3 GI:556503834
gggtcgttagctcagttggtagagcagttgacttttaatcaattggtcgcaggttcgaat
cctgcacgacccacca
              
                            

Download fasta file
RegulonDB