RegulonDB RegulonDB 10.9: Gene Sequence
metU gene sequence


Size: 77        A: 19  T: 18  G: 20  C: 20

Fasta

 

>metU E. coli K12. Version NC_000913.3 GI:556503834
ggctacgtagctcagttggttagagcacatcactcataatgatggggtcacaggttcgaa
tcccgtcgtagccacca
              
                            

Download fasta file
RegulonDB