RegulonDB RegulonDB 10.8: Gene Sequence
metY gene sequence


Size: 77        A: 15  T: 12  G: 24  C: 26

Fasta

 

>metY E. coli K12. Version NC_000913.3 GI:556503834
cgcggggtggagcagcctggtagctcgtcgggctcataacccgaagatcgtcggttcaaa
tccggcccccgcaacca
              
                            

Download fasta file
RegulonDB