RegulonDB RegulonDB 10.9: Gene Sequence
micF gene sequence


Size: 93        A: 18  T: 42  G: 11  C: 22

Fasta

 

>micF E. coli K12. Version NC_000913.3 GI:556503834
gctatcatcattaactttatttattaccgtcattcatttctgaatgtctgtttaccccta
tttcaaccggatgcctcgcattcggtttttttt
              
                            

Download fasta file
RegulonDB