RegulonDB RegulonDB 10.9: Gene Sequence
rnpB gene sequence


Size: 377        A: 87  T: 57  G: 132  C: 101

Fasta

 

>rnpB E. coli K12. Version NC_000913.3 GI:556503834
gaagctgaccagacagtcgccgcttcgtcgtcgtcctcttcgggggagacgggcggaggg
gaggaaagtccgggctccatagggcagggtgccaggtaacgcctgggggggaaacccacg
accagtgcaacagagagcaaaccgccgatggcccgcgcaagcgggatcaggtaagggtga
aagggtgcggtaagagcgcaccgcgcggctggtaacagtccgtggcacggtaaactccac
ccggagcaaggccaaataggggttcataaggtacggcccgtactgaacccgggtaggctg
cttgagccagtgagcgattgctggcctagatgaatgactgtccacgacagaacccggctt
atcggtcagtttcacct
              
                            

Download fasta file
RegulonDB