RegulonDB RegulonDB 10.8: Gene Sequence
rrfA gene sequence


Size: 120        A: 24  T: 21  G: 41  C: 34

Fasta

 

>rrfA E. coli K12. Version NC_000913.3 GI:556503834
tgcctggcggcagtagcgcggtggtcccacctgaccccatgccgaactcagaagtgaaac
gccgtagcgccgatggtagtgtggggtctcctcatgcgagagtagggaactgccaggcat
              
                            

Download fasta file
RegulonDB