RegulonDB RegulonDB 10.9: Gene Sequence
rrfH gene sequence


Size: 120        A: 23  T: 20  G: 41  C: 36

Fasta

 

>rrfH E. coli K12. Version NC_000913.3 GI:556503834
tgcctggcggccgtagcgcggtggtcccacctgaccccatgccgaactcagaagtgaaac
gccgtagcgccgatggtagtgtggggtctccccatgcgagagtagggaactgccaggcat
              
                            

Download fasta file
RegulonDB