RegulonDB RegulonDB 10.9: Gene Sequence
serU gene sequence


Size: 90        A: 20  T: 13  G: 29  C: 28

Fasta

 

>serU E. coli K12. Version NC_000913.3 GI:556503834
ggagagatgccggagcggctgaacggaccggtctcgaaaaccggagtaggggcaactcta
ccgggggttcaaatccccctctctccgcca
              
                            

Download fasta file
RegulonDB