RegulonDB RegulonDB 10.8: Gene Sequence
serX gene sequence


Size: 88        A: 18  T: 16  G: 30  C: 24

Fasta

 

>serX E. coli K12. Version NC_000913.3 GI:556503834
ggtgaggtgtccgagtggctgaaggagcacgcctggaaagtgtgtatacggcaacgtatc
gggggttcgaatccccccctcaccgcca
              
                            

Download fasta file
RegulonDB