RegulonDB RegulonDB 10.8: Gene Sequence
ssrS gene sequence


Size: 183        A: 41  T: 41  G: 50  C: 51

Fasta

 

>ssrS E. coli K12. Version NC_000913.3 GI:556503834
atttctctgagatgttcgcaagcgggccagtcccctgagccgatatttcataccacaaga
atgtggcgctccgcggttggtgagcatgctcggtccgtccgagaagccttaaaactgcga
cgacacattcaccttgaaccaagggttcaagggttacagcctgcggcggcatctcggaga
ttc
              
                            

Download fasta file
RegulonDB